Review



flat bottom black non binding greiner bio one  (Greiner Bio)


Bioz Verified Symbol Greiner Bio is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Greiner Bio flat bottom black non binding greiner bio one
    Flat Bottom Black Non Binding Greiner Bio One, supplied by Greiner Bio, used in various techniques. Bioz Stars score: 95/100, based on 182 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non+binding+greiner+bio+one/Microplate+384+Well+Ps+F-Bottom+Black/pmc12446458__41467_2025_64082_MOESM1_ESM-119-74-78
    Average 95 stars, based on 182 article reviews
    flat bottom black non binding greiner bio one - by Bioz Stars, 2026-09
    95/100 stars

    Images

    Related Articles

    Virus:

    Article Title: Structural insights into DNMT5-mediated ATP-dependent high-fidelity epigenome maintenance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli BL21(DE3) competent cells Novagen Cat#69450-3 E. coli DH10Bac competent cells Gibco Cat#10361012 Chemicals, peptides, and recombinant proteins pFastBac HT B vector Gibco Cat#10584027 1M Tris-HCl pH8.0 Invitrogen Cat#15568-025 Sodium Chloride Fisher Cat#S640-10 b-mercaptoethanol Sigma-Aldrich Cat#M6250-100ML DTT Gold Biotechnology Cat#DTT100 5.0 M Magnesium chloride hexahydrate Hampton Cat#HR2-803 AMP-PNP Sigma-Aldrich Cat#10102547001 S-adenosyl-L-homocysteine (SAH) Sigma-Aldrich Cat#A9384-25MG Protease inhibitor cocktail tablets, EDTA-free Sigma-Aldrich Cat#S8830-20TAB S-adenosyl-L-methionine (SAM) Millipore-Sigma Cat# A4377 Mant-AMP-PNP Biorbyt Cat#orb63431 50 ml Phenylmethanesulfonyl fluoride (PMSF) Roche Cat#11359061001 Sf-900 II SFM Gibco Cat#10-902-104 Grace’s Insect Medium, supplemented Gibco Cat#11-605-094 Q5 site-directed mutagenesis kit New England Biolabs Cat#E0554S Fetal bovine serum (FBS) Gemini Cat#900-108 Microplate, 384 well, PS, F-bottom, Black, Non-binding Greiner Bio-one Cat781900 Microplate, 384 well, PS, F-bottom, Black, Med. binding Greiner Bio-one Cat#781076 Microplate, 96 well, PS, F-bottom, Clear Greiner Bio-one Cat#655101 S-[methyl-3 H]-adenosyl-L-methionine Perkin Elmer Cat# NET155H ATP Thermo Scientific Cat#R1441 Benzonase nuclease Millipore-Sigma Cat# E1014 Ultima Gold Perkin Elmer Cat# 6013321 Critical commercial assays ADP-Glo Kinase Assay Promega Cat#V6930 ATPase/GTPase activity assay kit Sigma-Aldrich Cat#MAK113 Deposited data apo-DNMT5 coordinate This paper PDB: 7R76 apo-DNMT5 map This paper EMDB: EMD-24292 DNMT5 binary complex coordinate This paper PDB: 7R77 DNMT5 binary complex map This paper EMDB: EMD-24294 DNMT5 pseudo-ternary complex coordinate This paper PDB: 7T02 DNMT5 pseudo-ternary complex map This paper EMDB: EMD-25577 DNMT5 quaternary complex coordinate This paper PDB: 7R78 DNMT5 quaternary complex map This paper EMDB: EMD-24295 Experimental models: Cell lines insect cell Spodoptera frugiperda Sf9 Gibco Cat#11496015 Trichoplusia ni High Five cells Gibco Cat#B85502 (Continued on next page) Molecular Cell 82, 1186–1198.e1–e6, March 17, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides hmDNA-F:CCATGCGCTGACACTAGA ATTGCCTAAGACCATACA IDT N/A hmDNA-R:TGTATGGTCTTAGGCAAT TCTAGTGTCAG/iMedC/GCATGG, /iMedC/=5-methyl cytosine IDT N/A umDNA-R:TGTATGGTCTTAGGCAAT TCTAGTGTCAGCGCATGG IDT N/A FAM-hmDNA-F:/56-FAM/CCATGCGC TGACACTAGAATTGCCTAAG ACCA TACA IDT N/A DNA_60bp_F: CATGGCCTAAGCCGGAC TGAATGAGCAAGCTTCCGGAGAATTCT GCCGGACTGCAGATGC Dumesic et al., 2020 N/A DNA_mCG_60bp_F: CATGGCCTAAGC/ iMedC/GGACTGAATGAGCAAGCTTC/ iMedC/GGAGAATTCTGC/iMedC/ GGACTGCAGATGC Dumesic et al., 2020 N/A Biot_DNA_60bp_Rev: 5Biosg/GCATCTGC AGTCCGGCAGAATTCTCCGGAAGCTTG CTCATTCAGTCCGGCTTAGGCCATG This paper N/A Single_mCG_60bp_Fw: CATGGCCTAAG CaGGACTGAATGAGCAAGCTTC/iMe-dC/ GGAGAATTCTGCaGGACTGCAGATGC Dumesic et al., 2020 N/A Biot_SingleCG_60bp_Rev: 5Biosg/GCAT CTGCAGTCCtGCAGAATTCTCCGGAAGC TTGCTCATTCAGTCCtGCTTAGGCCATG This paper N/A Recombinant DNA pFastBac-HTB-DNMT5 This paper N/A pFastBac-HTB-DNMT5 E637A This paper N/A pFastBac-HTB-DNMT5 GS loop mutant This paper N/A pFastBac-HTB-DNMT5 Q668A This paper N/A pFastBac-HTB-DNMT5 R672A This paper N/A pFastBac-HTB-DNMT5 R2036A This paper N/A pFastBac-HTB-DNMT5 N447A This paper N/A pFastBac-HTB-DNMT5 C684G This paper N/A pFastBac-HTB-DNMT5 N669G/Q673A This paper N/A Software and algorithms RELION-3 Zivanov et al., 2018 https://www3.mrc-lmb.cam.ac.uk/relion/; RRID: SCR_016274 Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/ personal/pemsley/coot/; RRID: SCR_014222 UCSF Chimera Pettersen et al., 2004 https://www.cgl.ucsf.edu/chimera/; RRID: SCR_004097 Phenix Adams et al., 2010 https://phenix-online.org/; RRID: SCR_014224 Pymol Schrodinger LLC https://pymol.org/2/; RRID: SCR_000305 Prism 9 GraphPad https://www.graphpad.com/; RRID: SCR_002798 (Continued on next page) e2 Molecular Cell 82, 1186–1198.e1–e6, March 17, 2022

    Recombinant:

    Article Title: Structural insights into DNMT5-mediated ATP-dependent high-fidelity epigenome maintenance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli BL21(DE3) competent cells Novagen Cat#69450-3 E. coli DH10Bac competent cells Gibco Cat#10361012 Chemicals, peptides, and recombinant proteins pFastBac HT B vector Gibco Cat#10584027 1M Tris-HCl pH8.0 Invitrogen Cat#15568-025 Sodium Chloride Fisher Cat#S640-10 b-mercaptoethanol Sigma-Aldrich Cat#M6250-100ML DTT Gold Biotechnology Cat#DTT100 5.0 M Magnesium chloride hexahydrate Hampton Cat#HR2-803 AMP-PNP Sigma-Aldrich Cat#10102547001 S-adenosyl-L-homocysteine (SAH) Sigma-Aldrich Cat#A9384-25MG Protease inhibitor cocktail tablets, EDTA-free Sigma-Aldrich Cat#S8830-20TAB S-adenosyl-L-methionine (SAM) Millipore-Sigma Cat# A4377 Mant-AMP-PNP Biorbyt Cat#orb63431 50 ml Phenylmethanesulfonyl fluoride (PMSF) Roche Cat#11359061001 Sf-900 II SFM Gibco Cat#10-902-104 Grace’s Insect Medium, supplemented Gibco Cat#11-605-094 Q5 site-directed mutagenesis kit New England Biolabs Cat#E0554S Fetal bovine serum (FBS) Gemini Cat#900-108 Microplate, 384 well, PS, F-bottom, Black, Non-binding Greiner Bio-one Cat781900 Microplate, 384 well, PS, F-bottom, Black, Med. binding Greiner Bio-one Cat#781076 Microplate, 96 well, PS, F-bottom, Clear Greiner Bio-one Cat#655101 S-[methyl-3 H]-adenosyl-L-methionine Perkin Elmer Cat# NET155H ATP Thermo Scientific Cat#R1441 Benzonase nuclease Millipore-Sigma Cat# E1014 Ultima Gold Perkin Elmer Cat# 6013321 Critical commercial assays ADP-Glo Kinase Assay Promega Cat#V6930 ATPase/GTPase activity assay kit Sigma-Aldrich Cat#MAK113 Deposited data apo-DNMT5 coordinate This paper PDB: 7R76 apo-DNMT5 map This paper EMDB: EMD-24292 DNMT5 binary complex coordinate This paper PDB: 7R77 DNMT5 binary complex map This paper EMDB: EMD-24294 DNMT5 pseudo-ternary complex coordinate This paper PDB: 7T02 DNMT5 pseudo-ternary complex map This paper EMDB: EMD-25577 DNMT5 quaternary complex coordinate This paper PDB: 7R78 DNMT5 quaternary complex map This paper EMDB: EMD-24295 Experimental models: Cell lines insect cell Spodoptera frugiperda Sf9 Gibco Cat#11496015 Trichoplusia ni High Five cells Gibco Cat#B85502 (Continued on next page) Molecular Cell 82, 1186–1198.e1–e6, March 17, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides hmDNA-F:CCATGCGCTGACACTAGA ATTGCCTAAGACCATACA IDT N/A hmDNA-R:TGTATGGTCTTAGGCAAT TCTAGTGTCAG/iMedC/GCATGG, /iMedC/=5-methyl cytosine IDT N/A umDNA-R:TGTATGGTCTTAGGCAAT TCTAGTGTCAGCGCATGG IDT N/A FAM-hmDNA-F:/56-FAM/CCATGCGC TGACACTAGAATTGCCTAAG ACCA TACA IDT N/A DNA_60bp_F: CATGGCCTAAGCCGGAC TGAATGAGCAAGCTTCCGGAGAATTCT GCCGGACTGCAGATGC Dumesic et al., 2020 N/A DNA_mCG_60bp_F: CATGGCCTAAGC/ iMedC/GGACTGAATGAGCAAGCTTC/ iMedC/GGAGAATTCTGC/iMedC/ GGACTGCAGATGC Dumesic et al., 2020 N/A Biot_DNA_60bp_Rev: 5Biosg/GCATCTGC AGTCCGGCAGAATTCTCCGGAAGCTTG CTCATTCAGTCCGGCTTAGGCCATG This paper N/A Single_mCG_60bp_Fw: CATGGCCTAAG CaGGACTGAATGAGCAAGCTTC/iMe-dC/ GGAGAATTCTGCaGGACTGCAGATGC Dumesic et al., 2020 N/A Biot_SingleCG_60bp_Rev: 5Biosg/GCAT CTGCAGTCCtGCAGAATTCTCCGGAAGC TTGCTCATTCAGTCCtGCTTAGGCCATG This paper N/A Recombinant DNA pFastBac-HTB-DNMT5 This paper N/A pFastBac-HTB-DNMT5 E637A This paper N/A pFastBac-HTB-DNMT5 GS loop mutant This paper N/A pFastBac-HTB-DNMT5 Q668A This paper N/A pFastBac-HTB-DNMT5 R672A This paper N/A pFastBac-HTB-DNMT5 R2036A This paper N/A pFastBac-HTB-DNMT5 N447A This paper N/A pFastBac-HTB-DNMT5 C684G This paper N/A pFastBac-HTB-DNMT5 N669G/Q673A This paper N/A Software and algorithms RELION-3 Zivanov et al., 2018 https://www3.mrc-lmb.cam.ac.uk/relion/; RRID: SCR_016274 Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/ personal/pemsley/coot/; RRID: SCR_014222 UCSF Chimera Pettersen et al., 2004 https://www.cgl.ucsf.edu/chimera/; RRID: SCR_004097 Phenix Adams et al., 2010 https://phenix-online.org/; RRID: SCR_014224 Pymol Schrodinger LLC https://pymol.org/2/; RRID: SCR_000305 Prism 9 GraphPad https://www.graphpad.com/; RRID: SCR_002798 (Continued on next page) e2 Molecular Cell 82, 1186–1198.e1–e6, March 17, 2022

    Protease Inhibitor:

    Article Title: Structural insights into DNMT5-mediated ATP-dependent high-fidelity epigenome maintenance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli BL21(DE3) competent cells Novagen Cat#69450-3 E. coli DH10Bac competent cells Gibco Cat#10361012 Chemicals, peptides, and recombinant proteins pFastBac HT B vector Gibco Cat#10584027 1M Tris-HCl pH8.0 Invitrogen Cat#15568-025 Sodium Chloride Fisher Cat#S640-10 b-mercaptoethanol Sigma-Aldrich Cat#M6250-100ML DTT Gold Biotechnology Cat#DTT100 5.0 M Magnesium chloride hexahydrate Hampton Cat#HR2-803 AMP-PNP Sigma-Aldrich Cat#10102547001 S-adenosyl-L-homocysteine (SAH) Sigma-Aldrich Cat#A9384-25MG Protease inhibitor cocktail tablets, EDTA-free Sigma-Aldrich Cat#S8830-20TAB S-adenosyl-L-methionine (SAM) Millipore-Sigma Cat# A4377 Mant-AMP-PNP Biorbyt Cat#orb63431 50 ml Phenylmethanesulfonyl fluoride (PMSF) Roche Cat#11359061001 Sf-900 II SFM Gibco Cat#10-902-104 Grace’s Insect Medium, supplemented Gibco Cat#11-605-094 Q5 site-directed mutagenesis kit New England Biolabs Cat#E0554S Fetal bovine serum (FBS) Gemini Cat#900-108 Microplate, 384 well, PS, F-bottom, Black, Non-binding Greiner Bio-one Cat781900 Microplate, 384 well, PS, F-bottom, Black, Med. binding Greiner Bio-one Cat#781076 Microplate, 96 well, PS, F-bottom, Clear Greiner Bio-one Cat#655101 S-[methyl-3 H]-adenosyl-L-methionine Perkin Elmer Cat# NET155H ATP Thermo Scientific Cat#R1441 Benzonase nuclease Millipore-Sigma Cat# E1014 Ultima Gold Perkin Elmer Cat# 6013321 Critical commercial assays ADP-Glo Kinase Assay Promega Cat#V6930 ATPase/GTPase activity assay kit Sigma-Aldrich Cat#MAK113 Deposited data apo-DNMT5 coordinate This paper PDB: 7R76 apo-DNMT5 map This paper EMDB: EMD-24292 DNMT5 binary complex coordinate This paper PDB: 7R77 DNMT5 binary complex map This paper EMDB: EMD-24294 DNMT5 pseudo-ternary complex coordinate This paper PDB: 7T02 DNMT5 pseudo-ternary complex map This paper EMDB: EMD-25577 DNMT5 quaternary complex coordinate This paper PDB: 7R78 DNMT5 quaternary complex map This paper EMDB: EMD-24295 Experimental models: Cell lines insect cell Spodoptera frugiperda Sf9 Gibco Cat#11496015 Trichoplusia ni High Five cells Gibco Cat#B85502 (Continued on next page) Molecular Cell 82, 1186–1198.e1–e6, March 17, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides hmDNA-F:CCATGCGCTGACACTAGA ATTGCCTAAGACCATACA IDT N/A hmDNA-R:TGTATGGTCTTAGGCAAT TCTAGTGTCAG/iMedC/GCATGG, /iMedC/=5-methyl cytosine IDT N/A umDNA-R:TGTATGGTCTTAGGCAAT TCTAGTGTCAGCGCATGG IDT N/A FAM-hmDNA-F:/56-FAM/CCATGCGC TGACACTAGAATTGCCTAAG ACCA TACA IDT N/A DNA_60bp_F: CATGGCCTAAGCCGGAC TGAATGAGCAAGCTTCCGGAGAATTCT GCCGGACTGCAGATGC Dumesic et al., 2020 N/A DNA_mCG_60bp_F: CATGGCCTAAGC/ iMedC/GGACTGAATGAGCAAGCTTC/ iMedC/GGAGAATTCTGC/iMedC/ GGACTGCAGATGC Dumesic et al., 2020 N/A Biot_DNA_60bp_Rev: 5Biosg/GCATCTGC AGTCCGGCAGAATTCTCCGGAAGCTTG CTCATTCAGTCCGGCTTAGGCCATG This paper N/A Single_mCG_60bp_Fw: CATGGCCTAAG CaGGACTGAATGAGCAAGCTTC/iMe-dC/ GGAGAATTCTGCaGGACTGCAGATGC Dumesic et al., 2020 N/A Biot_SingleCG_60bp_Rev: 5Biosg/GCAT CTGCAGTCCtGCAGAATTCTCCGGAAGC TTGCTCATTCAGTCCtGCTTAGGCCATG This paper N/A Recombinant DNA pFastBac-HTB-DNMT5 This paper N/A pFastBac-HTB-DNMT5 E637A This paper N/A pFastBac-HTB-DNMT5 GS loop mutant This paper N/A pFastBac-HTB-DNMT5 Q668A This paper N/A pFastBac-HTB-DNMT5 R672A This paper N/A pFastBac-HTB-DNMT5 R2036A This paper N/A pFastBac-HTB-DNMT5 N447A This paper N/A pFastBac-HTB-DNMT5 C684G This paper N/A pFastBac-HTB-DNMT5 N669G/Q673A This paper N/A Software and algorithms RELION-3 Zivanov et al., 2018 https://www3.mrc-lmb.cam.ac.uk/relion/; RRID: SCR_016274 Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/ personal/pemsley/coot/; RRID: SCR_014222 UCSF Chimera Pettersen et al., 2004 https://www.cgl.ucsf.edu/chimera/; RRID: SCR_004097 Phenix Adams et al., 2010 https://phenix-online.org/; RRID: SCR_014224 Pymol Schrodinger LLC https://pymol.org/2/; RRID: SCR_000305 Prism 9 GraphPad https://www.graphpad.com/; RRID: SCR_002798 (Continued on next page) e2 Molecular Cell 82, 1186–1198.e1–e6, March 17, 2022

    Mutagenesis:

    Article Title: Structural insights into DNMT5-mediated ATP-dependent high-fidelity epigenome maintenance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli BL21(DE3) competent cells Novagen Cat#69450-3 E. coli DH10Bac competent cells Gibco Cat#10361012 Chemicals, peptides, and recombinant proteins pFastBac HT B vector Gibco Cat#10584027 1M Tris-HCl pH8.0 Invitrogen Cat#15568-025 Sodium Chloride Fisher Cat#S640-10 b-mercaptoethanol Sigma-Aldrich Cat#M6250-100ML DTT Gold Biotechnology Cat#DTT100 5.0 M Magnesium chloride hexahydrate Hampton Cat#HR2-803 AMP-PNP Sigma-Aldrich Cat#10102547001 S-adenosyl-L-homocysteine (SAH) Sigma-Aldrich Cat#A9384-25MG Protease inhibitor cocktail tablets, EDTA-free Sigma-Aldrich Cat#S8830-20TAB S-adenosyl-L-methionine (SAM) Millipore-Sigma Cat# A4377 Mant-AMP-PNP Biorbyt Cat#orb63431 50 ml Phenylmethanesulfonyl fluoride (PMSF) Roche Cat#11359061001 Sf-900 II SFM Gibco Cat#10-902-104 Grace’s Insect Medium, supplemented Gibco Cat#11-605-094 Q5 site-directed mutagenesis kit New England Biolabs Cat#E0554S Fetal bovine serum (FBS) Gemini Cat#900-108 Microplate, 384 well, PS, F-bottom, Black, Non-binding Greiner Bio-one Cat781900 Microplate, 384 well, PS, F-bottom, Black, Med. binding Greiner Bio-one Cat#781076 Microplate, 96 well, PS, F-bottom, Clear Greiner Bio-one Cat#655101 S-[methyl-3 H]-adenosyl-L-methionine Perkin Elmer Cat# NET155H ATP Thermo Scientific Cat#R1441 Benzonase nuclease Millipore-Sigma Cat# E1014 Ultima Gold Perkin Elmer Cat# 6013321 Critical commercial assays ADP-Glo Kinase Assay Promega Cat#V6930 ATPase/GTPase activity assay kit Sigma-Aldrich Cat#MAK113 Deposited data apo-DNMT5 coordinate This paper PDB: 7R76 apo-DNMT5 map This paper EMDB: EMD-24292 DNMT5 binary complex coordinate This paper PDB: 7R77 DNMT5 binary complex map This paper EMDB: EMD-24294 DNMT5 pseudo-ternary complex coordinate This paper PDB: 7T02 DNMT5 pseudo-ternary complex map This paper EMDB: EMD-25577 DNMT5 quaternary complex coordinate This paper PDB: 7R78 DNMT5 quaternary complex map This paper EMDB: EMD-24295 Experimental models: Cell lines insect cell Spodoptera frugiperda Sf9 Gibco Cat#11496015 Trichoplusia ni High Five cells Gibco Cat#B85502 (Continued on next page) Molecular Cell 82, 1186–1198.e1–e6, March 17, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides hmDNA-F:CCATGCGCTGACACTAGA ATTGCCTAAGACCATACA IDT N/A hmDNA-R:TGTATGGTCTTAGGCAAT TCTAGTGTCAG/iMedC/GCATGG, /iMedC/=5-methyl cytosine IDT N/A umDNA-R:TGTATGGTCTTAGGCAAT TCTAGTGTCAGCGCATGG IDT N/A FAM-hmDNA-F:/56-FAM/CCATGCGC TGACACTAGAATTGCCTAAG ACCA TACA IDT N/A DNA_60bp_F: CATGGCCTAAGCCGGAC TGAATGAGCAAGCTTCCGGAGAATTCT GCCGGACTGCAGATGC Dumesic et al., 2020 N/A DNA_mCG_60bp_F: CATGGCCTAAGC/ iMedC/GGACTGAATGAGCAAGCTTC/ iMedC/GGAGAATTCTGC/iMedC/ GGACTGCAGATGC Dumesic et al., 2020 N/A Biot_DNA_60bp_Rev: 5Biosg/GCATCTGC AGTCCGGCAGAATTCTCCGGAAGCTTG CTCATTCAGTCCGGCTTAGGCCATG This paper N/A Single_mCG_60bp_Fw: CATGGCCTAAG CaGGACTGAATGAGCAAGCTTC/iMe-dC/ GGAGAATTCTGCaGGACTGCAGATGC Dumesic et al., 2020 N/A Biot_SingleCG_60bp_Rev: 5Biosg/GCAT CTGCAGTCCtGCAGAATTCTCCGGAAGC TTGCTCATTCAGTCCtGCTTAGGCCATG This paper N/A Recombinant DNA pFastBac-HTB-DNMT5 This paper N/A pFastBac-HTB-DNMT5 E637A This paper N/A pFastBac-HTB-DNMT5 GS loop mutant This paper N/A pFastBac-HTB-DNMT5 Q668A This paper N/A pFastBac-HTB-DNMT5 R672A This paper N/A pFastBac-HTB-DNMT5 R2036A This paper N/A pFastBac-HTB-DNMT5 N447A This paper N/A pFastBac-HTB-DNMT5 C684G This paper N/A pFastBac-HTB-DNMT5 N669G/Q673A This paper N/A Software and algorithms RELION-3 Zivanov et al., 2018 https://www3.mrc-lmb.cam.ac.uk/relion/; RRID: SCR_016274 Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/ personal/pemsley/coot/; RRID: SCR_014222 UCSF Chimera Pettersen et al., 2004 https://www.cgl.ucsf.edu/chimera/; RRID: SCR_004097 Phenix Adams et al., 2010 https://phenix-online.org/; RRID: SCR_014224 Pymol Schrodinger LLC https://pymol.org/2/; RRID: SCR_000305 Prism 9 GraphPad https://www.graphpad.com/; RRID: SCR_002798 (Continued on next page) e2 Molecular Cell 82, 1186–1198.e1–e6, March 17, 2022

    Binding Assay:

    Article Title: Structural insights into DNMT5-mediated ATP-dependent high-fidelity epigenome maintenance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli BL21(DE3) competent cells Novagen Cat#69450-3 E. coli DH10Bac competent cells Gibco Cat#10361012 Chemicals, peptides, and recombinant proteins pFastBac HT B vector Gibco Cat#10584027 1M Tris-HCl pH8.0 Invitrogen Cat#15568-025 Sodium Chloride Fisher Cat#S640-10 b-mercaptoethanol Sigma-Aldrich Cat#M6250-100ML DTT Gold Biotechnology Cat#DTT100 5.0 M Magnesium chloride hexahydrate Hampton Cat#HR2-803 AMP-PNP Sigma-Aldrich Cat#10102547001 S-adenosyl-L-homocysteine (SAH) Sigma-Aldrich Cat#A9384-25MG Protease inhibitor cocktail tablets, EDTA-free Sigma-Aldrich Cat#S8830-20TAB S-adenosyl-L-methionine (SAM) Millipore-Sigma Cat# A4377 Mant-AMP-PNP Biorbyt Cat#orb63431 50 ml Phenylmethanesulfonyl fluoride (PMSF) Roche Cat#11359061001 Sf-900 II SFM Gibco Cat#10-902-104 Grace’s Insect Medium, supplemented Gibco Cat#11-605-094 Q5 site-directed mutagenesis kit New England Biolabs Cat#E0554S Fetal bovine serum (FBS) Gemini Cat#900-108 Microplate, 384 well, PS, F-bottom, Black, Non-binding Greiner Bio-one Cat781900 Microplate, 384 well, PS, F-bottom, Black, Med. binding Greiner Bio-one Cat#781076 Microplate, 96 well, PS, F-bottom, Clear Greiner Bio-one Cat#655101 S-[methyl-3 H]-adenosyl-L-methionine Perkin Elmer Cat# NET155H ATP Thermo Scientific Cat#R1441 Benzonase nuclease Millipore-Sigma Cat# E1014 Ultima Gold Perkin Elmer Cat# 6013321 Critical commercial assays ADP-Glo Kinase Assay Promega Cat#V6930 ATPase/GTPase activity assay kit Sigma-Aldrich Cat#MAK113 Deposited data apo-DNMT5 coordinate This paper PDB: 7R76 apo-DNMT5 map This paper EMDB: EMD-24292 DNMT5 binary complex coordinate This paper PDB: 7R77 DNMT5 binary complex map This paper EMDB: EMD-24294 DNMT5 pseudo-ternary complex coordinate This paper PDB: 7T02 DNMT5 pseudo-ternary complex map This paper EMDB: EMD-25577 DNMT5 quaternary complex coordinate This paper PDB: 7R78 DNMT5 quaternary complex map This paper EMDB: EMD-24295 Experimental models: Cell lines insect cell Spodoptera frugiperda Sf9 Gibco Cat#11496015 Trichoplusia ni High Five cells Gibco Cat#B85502 (Continued on next page) Molecular Cell 82, 1186–1198.e1–e6, March 17, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides hmDNA-F:CCATGCGCTGACACTAGA ATTGCCTAAGACCATACA IDT N/A hmDNA-R:TGTATGGTCTTAGGCAAT TCTAGTGTCAG/iMedC/GCATGG, /iMedC/=5-methyl cytosine IDT N/A umDNA-R:TGTATGGTCTTAGGCAAT TCTAGTGTCAGCGCATGG IDT N/A FAM-hmDNA-F:/56-FAM/CCATGCGC TGACACTAGAATTGCCTAAG ACCA TACA IDT N/A DNA_60bp_F: CATGGCCTAAGCCGGAC TGAATGAGCAAGCTTCCGGAGAATTCT GCCGGACTGCAGATGC Dumesic et al., 2020 N/A DNA_mCG_60bp_F: CATGGCCTAAGC/ iMedC/GGACTGAATGAGCAAGCTTC/ iMedC/GGAGAATTCTGC/iMedC/ GGACTGCAGATGC Dumesic et al., 2020 N/A Biot_DNA_60bp_Rev: 5Biosg/GCATCTGC AGTCCGGCAGAATTCTCCGGAAGCTTG CTCATTCAGTCCGGCTTAGGCCATG This paper N/A Single_mCG_60bp_Fw: CATGGCCTAAG CaGGACTGAATGAGCAAGCTTC/iMe-dC/ GGAGAATTCTGCaGGACTGCAGATGC Dumesic et al., 2020 N/A Biot_SingleCG_60bp_Rev: 5Biosg/GCAT CTGCAGTCCtGCAGAATTCTCCGGAAGC TTGCTCATTCAGTCCtGCTTAGGCCATG This paper N/A Recombinant DNA pFastBac-HTB-DNMT5 This paper N/A pFastBac-HTB-DNMT5 E637A This paper N/A pFastBac-HTB-DNMT5 GS loop mutant This paper N/A pFastBac-HTB-DNMT5 Q668A This paper N/A pFastBac-HTB-DNMT5 R672A This paper N/A pFastBac-HTB-DNMT5 R2036A This paper N/A pFastBac-HTB-DNMT5 N447A This paper N/A pFastBac-HTB-DNMT5 C684G This paper N/A pFastBac-HTB-DNMT5 N669G/Q673A This paper N/A Software and algorithms RELION-3 Zivanov et al., 2018 https://www3.mrc-lmb.cam.ac.uk/relion/; RRID: SCR_016274 Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/ personal/pemsley/coot/; RRID: SCR_014222 UCSF Chimera Pettersen et al., 2004 https://www.cgl.ucsf.edu/chimera/; RRID: SCR_004097 Phenix Adams et al., 2010 https://phenix-online.org/; RRID: SCR_014224 Pymol Schrodinger LLC https://pymol.org/2/; RRID: SCR_000305 Prism 9 GraphPad https://www.graphpad.com/; RRID: SCR_002798 (Continued on next page) e2 Molecular Cell 82, 1186–1198.e1–e6, March 17, 2022

    Kinase Assay:

    Article Title: Structural insights into DNMT5-mediated ATP-dependent high-fidelity epigenome maintenance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli BL21(DE3) competent cells Novagen Cat#69450-3 E. coli DH10Bac competent cells Gibco Cat#10361012 Chemicals, peptides, and recombinant proteins pFastBac HT B vector Gibco Cat#10584027 1M Tris-HCl pH8.0 Invitrogen Cat#15568-025 Sodium Chloride Fisher Cat#S640-10 b-mercaptoethanol Sigma-Aldrich Cat#M6250-100ML DTT Gold Biotechnology Cat#DTT100 5.0 M Magnesium chloride hexahydrate Hampton Cat#HR2-803 AMP-PNP Sigma-Aldrich Cat#10102547001 S-adenosyl-L-homocysteine (SAH) Sigma-Aldrich Cat#A9384-25MG Protease inhibitor cocktail tablets, EDTA-free Sigma-Aldrich Cat#S8830-20TAB S-adenosyl-L-methionine (SAM) Millipore-Sigma Cat# A4377 Mant-AMP-PNP Biorbyt Cat#orb63431 50 ml Phenylmethanesulfonyl fluoride (PMSF) Roche Cat#11359061001 Sf-900 II SFM Gibco Cat#10-902-104 Grace’s Insect Medium, supplemented Gibco Cat#11-605-094 Q5 site-directed mutagenesis kit New England Biolabs Cat#E0554S Fetal bovine serum (FBS) Gemini Cat#900-108 Microplate, 384 well, PS, F-bottom, Black, Non-binding Greiner Bio-one Cat781900 Microplate, 384 well, PS, F-bottom, Black, Med. binding Greiner Bio-one Cat#781076 Microplate, 96 well, PS, F-bottom, Clear Greiner Bio-one Cat#655101 S-[methyl-3 H]-adenosyl-L-methionine Perkin Elmer Cat# NET155H ATP Thermo Scientific Cat#R1441 Benzonase nuclease Millipore-Sigma Cat# E1014 Ultima Gold Perkin Elmer Cat# 6013321 Critical commercial assays ADP-Glo Kinase Assay Promega Cat#V6930 ATPase/GTPase activity assay kit Sigma-Aldrich Cat#MAK113 Deposited data apo-DNMT5 coordinate This paper PDB: 7R76 apo-DNMT5 map This paper EMDB: EMD-24292 DNMT5 binary complex coordinate This paper PDB: 7R77 DNMT5 binary complex map This paper EMDB: EMD-24294 DNMT5 pseudo-ternary complex coordinate This paper PDB: 7T02 DNMT5 pseudo-ternary complex map This paper EMDB: EMD-25577 DNMT5 quaternary complex coordinate This paper PDB: 7R78 DNMT5 quaternary complex map This paper EMDB: EMD-24295 Experimental models: Cell lines insect cell Spodoptera frugiperda Sf9 Gibco Cat#11496015 Trichoplusia ni High Five cells Gibco Cat#B85502 (Continued on next page) Molecular Cell 82, 1186–1198.e1–e6, March 17, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides hmDNA-F:CCATGCGCTGACACTAGA ATTGCCTAAGACCATACA IDT N/A hmDNA-R:TGTATGGTCTTAGGCAAT TCTAGTGTCAG/iMedC/GCATGG, /iMedC/=5-methyl cytosine IDT N/A umDNA-R:TGTATGGTCTTAGGCAAT TCTAGTGTCAGCGCATGG IDT N/A FAM-hmDNA-F:/56-FAM/CCATGCGC TGACACTAGAATTGCCTAAG ACCA TACA IDT N/A DNA_60bp_F: CATGGCCTAAGCCGGAC TGAATGAGCAAGCTTCCGGAGAATTCT GCCGGACTGCAGATGC Dumesic et al., 2020 N/A DNA_mCG_60bp_F: CATGGCCTAAGC/ iMedC/GGACTGAATGAGCAAGCTTC/ iMedC/GGAGAATTCTGC/iMedC/ GGACTGCAGATGC Dumesic et al., 2020 N/A Biot_DNA_60bp_Rev: 5Biosg/GCATCTGC AGTCCGGCAGAATTCTCCGGAAGCTTG CTCATTCAGTCCGGCTTAGGCCATG This paper N/A Single_mCG_60bp_Fw: CATGGCCTAAG CaGGACTGAATGAGCAAGCTTC/iMe-dC/ GGAGAATTCTGCaGGACTGCAGATGC Dumesic et al., 2020 N/A Biot_SingleCG_60bp_Rev: 5Biosg/GCAT CTGCAGTCCtGCAGAATTCTCCGGAAGC TTGCTCATTCAGTCCtGCTTAGGCCATG This paper N/A Recombinant DNA pFastBac-HTB-DNMT5 This paper N/A pFastBac-HTB-DNMT5 E637A This paper N/A pFastBac-HTB-DNMT5 GS loop mutant This paper N/A pFastBac-HTB-DNMT5 Q668A This paper N/A pFastBac-HTB-DNMT5 R672A This paper N/A pFastBac-HTB-DNMT5 R2036A This paper N/A pFastBac-HTB-DNMT5 N447A This paper N/A pFastBac-HTB-DNMT5 C684G This paper N/A pFastBac-HTB-DNMT5 N669G/Q673A This paper N/A Software and algorithms RELION-3 Zivanov et al., 2018 https://www3.mrc-lmb.cam.ac.uk/relion/; RRID: SCR_016274 Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/ personal/pemsley/coot/; RRID: SCR_014222 UCSF Chimera Pettersen et al., 2004 https://www.cgl.ucsf.edu/chimera/; RRID: SCR_004097 Phenix Adams et al., 2010 https://phenix-online.org/; RRID: SCR_014224 Pymol Schrodinger LLC https://pymol.org/2/; RRID: SCR_000305 Prism 9 GraphPad https://www.graphpad.com/; RRID: SCR_002798 (Continued on next page) e2 Molecular Cell 82, 1186–1198.e1–e6, March 17, 2022

    Activity Assay:

    Article Title: Structural insights into DNMT5-mediated ATP-dependent high-fidelity epigenome maintenance.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli BL21(DE3) competent cells Novagen Cat#69450-3 E. coli DH10Bac competent cells Gibco Cat#10361012 Chemicals, peptides, and recombinant proteins pFastBac HT B vector Gibco Cat#10584027 1M Tris-HCl pH8.0 Invitrogen Cat#15568-025 Sodium Chloride Fisher Cat#S640-10 b-mercaptoethanol Sigma-Aldrich Cat#M6250-100ML DTT Gold Biotechnology Cat#DTT100 5.0 M Magnesium chloride hexahydrate Hampton Cat#HR2-803 AMP-PNP Sigma-Aldrich Cat#10102547001 S-adenosyl-L-homocysteine (SAH) Sigma-Aldrich Cat#A9384-25MG Protease inhibitor cocktail tablets, EDTA-free Sigma-Aldrich Cat#S8830-20TAB S-adenosyl-L-methionine (SAM) Millipore-Sigma Cat# A4377 Mant-AMP-PNP Biorbyt Cat#orb63431 50 ml Phenylmethanesulfonyl fluoride (PMSF) Roche Cat#11359061001 Sf-900 II SFM Gibco Cat#10-902-104 Grace’s Insect Medium, supplemented Gibco Cat#11-605-094 Q5 site-directed mutagenesis kit New England Biolabs Cat#E0554S Fetal bovine serum (FBS) Gemini Cat#900-108 Microplate, 384 well, PS, F-bottom, Black, Non-binding Greiner Bio-one Cat781900 Microplate, 384 well, PS, F-bottom, Black, Med. binding Greiner Bio-one Cat#781076 Microplate, 96 well, PS, F-bottom, Clear Greiner Bio-one Cat#655101 S-[methyl-3 H]-adenosyl-L-methionine Perkin Elmer Cat# NET155H ATP Thermo Scientific Cat#R1441 Benzonase nuclease Millipore-Sigma Cat# E1014 Ultima Gold Perkin Elmer Cat# 6013321 Critical commercial assays ADP-Glo Kinase Assay Promega Cat#V6930 ATPase/GTPase activity assay kit Sigma-Aldrich Cat#MAK113 Deposited data apo-DNMT5 coordinate This paper PDB: 7R76 apo-DNMT5 map This paper EMDB: EMD-24292 DNMT5 binary complex coordinate This paper PDB: 7R77 DNMT5 binary complex map This paper EMDB: EMD-24294 DNMT5 pseudo-ternary complex coordinate This paper PDB: 7T02 DNMT5 pseudo-ternary complex map This paper EMDB: EMD-25577 DNMT5 quaternary complex coordinate This paper PDB: 7R78 DNMT5 quaternary complex map This paper EMDB: EMD-24295 Experimental models: Cell lines insect cell Spodoptera frugiperda Sf9 Gibco Cat#11496015 Trichoplusia ni High Five cells Gibco Cat#B85502 (Continued on next page) Molecular Cell 82, 1186–1198.e1–e6, March 17, 2022 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Oligonucleotides hmDNA-F:CCATGCGCTGACACTAGA ATTGCCTAAGACCATACA IDT N/A hmDNA-R:TGTATGGTCTTAGGCAAT TCTAGTGTCAG/iMedC/GCATGG, /iMedC/=5-methyl cytosine IDT N/A umDNA-R:TGTATGGTCTTAGGCAAT TCTAGTGTCAGCGCATGG IDT N/A FAM-hmDNA-F:/56-FAM/CCATGCGC TGACACTAGAATTGCCTAAG ACCA TACA IDT N/A DNA_60bp_F: CATGGCCTAAGCCGGAC TGAATGAGCAAGCTTCCGGAGAATTCT GCCGGACTGCAGATGC Dumesic et al., 2020 N/A DNA_mCG_60bp_F: CATGGCCTAAGC/ iMedC/GGACTGAATGAGCAAGCTTC/ iMedC/GGAGAATTCTGC/iMedC/ GGACTGCAGATGC Dumesic et al., 2020 N/A Biot_DNA_60bp_Rev: 5Biosg/GCATCTGC AGTCCGGCAGAATTCTCCGGAAGCTTG CTCATTCAGTCCGGCTTAGGCCATG This paper N/A Single_mCG_60bp_Fw: CATGGCCTAAG CaGGACTGAATGAGCAAGCTTC/iMe-dC/ GGAGAATTCTGCaGGACTGCAGATGC Dumesic et al., 2020 N/A Biot_SingleCG_60bp_Rev: 5Biosg/GCAT CTGCAGTCCtGCAGAATTCTCCGGAAGC TTGCTCATTCAGTCCtGCTTAGGCCATG This paper N/A Recombinant DNA pFastBac-HTB-DNMT5 This paper N/A pFastBac-HTB-DNMT5 E637A This paper N/A pFastBac-HTB-DNMT5 GS loop mutant This paper N/A pFastBac-HTB-DNMT5 Q668A This paper N/A pFastBac-HTB-DNMT5 R672A This paper N/A pFastBac-HTB-DNMT5 R2036A This paper N/A pFastBac-HTB-DNMT5 N447A This paper N/A pFastBac-HTB-DNMT5 C684G This paper N/A pFastBac-HTB-DNMT5 N669G/Q673A This paper N/A Software and algorithms RELION-3 Zivanov et al., 2018 https://www3.mrc-lmb.cam.ac.uk/relion/; RRID: SCR_016274 Coot Emsley et al., 2010 https://www2.mrc-lmb.cam.ac.uk/ personal/pemsley/coot/; RRID: SCR_014222 UCSF Chimera Pettersen et al., 2004 https://www.cgl.ucsf.edu/chimera/; RRID: SCR_004097 Phenix Adams et al., 2010 https://phenix-online.org/; RRID: SCR_014224 Pymol Schrodinger LLC https://pymol.org/2/; RRID: SCR_000305 Prism 9 GraphPad https://www.graphpad.com/; RRID: SCR_002798 (Continued on next page) e2 Molecular Cell 82, 1186–1198.e1–e6, March 17, 2022

    Gentle:

    Article Title: IL4I1 Is a Metabolic Immune Checkpoint that Activates the AHR and Promotes Tumor Progression.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER GSVA http://bioconductor.org v1.32.0 Hmisc https://cran.r-project.org v4.2-0 Image Lab software 6.0.1 Bio-Rad https://www.bio-rad.com/de-de/product/ image-lab-software?ID=KRE6P5E8Z JCoRe https://github.com/ JULIELab/jcore-base v2.4 Limma http://bioconductor.org v3.40.6 and v3.42.2 Lumi http://bioconductor.org v2.36.0 MassHunter B06.00 or B10.00 software packages Agilent https://www.agilent.com/en/products/software- informatics/mass-spectrometry-software MassLynx 4.1 Software Waters https://www.waters.com/waters/en_US/MassLynx- MS-Software/nav.htm?cid=513662&locale=en_US MOFA http://bioconductor.org v1.0.0 mogene20sttranscriptcluster.db http://bioconductor.org v8.7.0 NIS Elements software version 4.13.04 Nikon https://www.microscope.healthcare.nikon. com/de_EU/products/software/nis-elements Oligo http://bioconductor.org v1.48.0 org.Hs.eg.db http://bioconductor.org v3.8.2 pd.hugene.2.0.st http://bioconductor.org v3.14.1 Progenesis QI Software Waters https://www.waters.com/waters/en_US/ Progenesis-QI-Software/nav.htm?cid= 134790655&lset=1&locale=en_ US&changedCountry=Y QuantAnalysis Bruker Daltonik v4.3 (Build 110.102.1532) R https://cran.r-project.org v3.6 RColorBrewer https://cran.r-project.org v1.1-2 StepOne Software v2.3 Thermo Fisher Scientific https://www.thermofisher.com/us/en/home/ technical-resources/software-downloads/ StepOne-and-StepOnePlus-Real-Time-PCRSystem.html SummarizedExperiment http://bioconductor.org v1.14.1 Survival https://cran.r-project.org v2.44-1.1 Survminer https://cran.r-project.org v0.4.5 TCGAbiolinks https://github.com/ BioinformaticsFMRP/ TCGAbiolinks v2.9.5 TScratch 1.0 Gebäck et al., 2009 https://github.com/cselab/TScratch UNIFI 1.8.2 Waters https://www.waters.com/waters/en_US/ UNIFI-Scientific-Information-System/ nav.htm?locale=en_US&cid=134801648 WGCNA https://cran.r-project.org v1.66 Other 0.45 mm pore filter Merck Millipore Catt# SLHA033SS 2-well cell culture inserts ibidi Cat# 80209 6 cm cell culture dish Greiner bio-one Cat# 628160 6-well plates TPP Cat# 92006 10 cm cell culture dish TPP Cat# 93100 24-well plates TPP Cat# 92424 70 mm cell strainers BD Biosciences Cat# 352350 96-well tissue culture test plates TPP Cat# 92696 Amicon Ultra-2 mL 30K Centrifugal Filter Units Merck Millipore Cat# UFC203024 (Continued on next page) ll OPEN ACCESS Cell 182, 1252–1270.e1–e20, September 3, 2020 e7 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Black clear bottom 96-well plates BD Biosciences Cat# 353219 Black, clear bottom poly-D-lysine coated 384-well plates Corning Cat# 3845 Gentle MACS tubes C Miltenyi Biotec, Cat# 130-093-237 Microplate, 96 well, PS, F-bottom (Chimney well) black, non-binding Greiner bio-one Cat# 655900 Mini-PROTEAN Tetra Cell electrophoresis system Bio-Rad Cat# 1658029FC Nitrocellulose membranes Bio-Rad Cat# 1620112 NuPAGE Novex Bis-Tris Mini Gels 4-12% Invitrogen Cat# NP0329 Polyvinylidene difluoride (PVDF) membrane Millipore Cat# IPVH00010 StarFrost Advanced Adhesive slides Engelbrecht Cat# 11270 Scripts used for data processing, analysis and figure generation in this study This paper https://github.com/ahmedasadik/AHR_IL4I1_ manuscript ll OPEN ACCESS Article ..

    Magnetic Cell Separation:

    Article Title: IL4I1 Is a Metabolic Immune Checkpoint that Activates the AHR and Promotes Tumor Progression.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER GSVA http://bioconductor.org v1.32.0 Hmisc https://cran.r-project.org v4.2-0 Image Lab software 6.0.1 Bio-Rad https://www.bio-rad.com/de-de/product/ image-lab-software?ID=KRE6P5E8Z JCoRe https://github.com/ JULIELab/jcore-base v2.4 Limma http://bioconductor.org v3.40.6 and v3.42.2 Lumi http://bioconductor.org v2.36.0 MassHunter B06.00 or B10.00 software packages Agilent https://www.agilent.com/en/products/software- informatics/mass-spectrometry-software MassLynx 4.1 Software Waters https://www.waters.com/waters/en_US/MassLynx- MS-Software/nav.htm?cid=513662&locale=en_US MOFA http://bioconductor.org v1.0.0 mogene20sttranscriptcluster.db http://bioconductor.org v8.7.0 NIS Elements software version 4.13.04 Nikon https://www.microscope.healthcare.nikon. com/de_EU/products/software/nis-elements Oligo http://bioconductor.org v1.48.0 org.Hs.eg.db http://bioconductor.org v3.8.2 pd.hugene.2.0.st http://bioconductor.org v3.14.1 Progenesis QI Software Waters https://www.waters.com/waters/en_US/ Progenesis-QI-Software/nav.htm?cid= 134790655&lset=1&locale=en_ US&changedCountry=Y QuantAnalysis Bruker Daltonik v4.3 (Build 110.102.1532) R https://cran.r-project.org v3.6 RColorBrewer https://cran.r-project.org v1.1-2 StepOne Software v2.3 Thermo Fisher Scientific https://www.thermofisher.com/us/en/home/ technical-resources/software-downloads/ StepOne-and-StepOnePlus-Real-Time-PCRSystem.html SummarizedExperiment http://bioconductor.org v1.14.1 Survival https://cran.r-project.org v2.44-1.1 Survminer https://cran.r-project.org v0.4.5 TCGAbiolinks https://github.com/ BioinformaticsFMRP/ TCGAbiolinks v2.9.5 TScratch 1.0 Gebäck et al., 2009 https://github.com/cselab/TScratch UNIFI 1.8.2 Waters https://www.waters.com/waters/en_US/ UNIFI-Scientific-Information-System/ nav.htm?locale=en_US&cid=134801648 WGCNA https://cran.r-project.org v1.66 Other 0.45 mm pore filter Merck Millipore Catt# SLHA033SS 2-well cell culture inserts ibidi Cat# 80209 6 cm cell culture dish Greiner bio-one Cat# 628160 6-well plates TPP Cat# 92006 10 cm cell culture dish TPP Cat# 93100 24-well plates TPP Cat# 92424 70 mm cell strainers BD Biosciences Cat# 352350 96-well tissue culture test plates TPP Cat# 92696 Amicon Ultra-2 mL 30K Centrifugal Filter Units Merck Millipore Cat# UFC203024 (Continued on next page) ll OPEN ACCESS Cell 182, 1252–1270.e1–e20, September 3, 2020 e7 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Black clear bottom 96-well plates BD Biosciences Cat# 353219 Black, clear bottom poly-D-lysine coated 384-well plates Corning Cat# 3845 Gentle MACS tubes C Miltenyi Biotec, Cat# 130-093-237 Microplate, 96 well, PS, F-bottom (Chimney well) black, non-binding Greiner bio-one Cat# 655900 Mini-PROTEAN Tetra Cell electrophoresis system Bio-Rad Cat# 1658029FC Nitrocellulose membranes Bio-Rad Cat# 1620112 NuPAGE Novex Bis-Tris Mini Gels 4-12% Invitrogen Cat# NP0329 Polyvinylidene difluoride (PVDF) membrane Millipore Cat# IPVH00010 StarFrost Advanced Adhesive slides Engelbrecht Cat# 11270 Scripts used for data processing, analysis and figure generation in this study This paper https://github.com/ahmedasadik/AHR_IL4I1_ manuscript ll OPEN ACCESS Article ..

    Electrophoresis:

    Article Title: IL4I1 Is a Metabolic Immune Checkpoint that Activates the AHR and Promotes Tumor Progression.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER GSVA http://bioconductor.org v1.32.0 Hmisc https://cran.r-project.org v4.2-0 Image Lab software 6.0.1 Bio-Rad https://www.bio-rad.com/de-de/product/ image-lab-software?ID=KRE6P5E8Z JCoRe https://github.com/ JULIELab/jcore-base v2.4 Limma http://bioconductor.org v3.40.6 and v3.42.2 Lumi http://bioconductor.org v2.36.0 MassHunter B06.00 or B10.00 software packages Agilent https://www.agilent.com/en/products/software- informatics/mass-spectrometry-software MassLynx 4.1 Software Waters https://www.waters.com/waters/en_US/MassLynx- MS-Software/nav.htm?cid=513662&locale=en_US MOFA http://bioconductor.org v1.0.0 mogene20sttranscriptcluster.db http://bioconductor.org v8.7.0 NIS Elements software version 4.13.04 Nikon https://www.microscope.healthcare.nikon. com/de_EU/products/software/nis-elements Oligo http://bioconductor.org v1.48.0 org.Hs.eg.db http://bioconductor.org v3.8.2 pd.hugene.2.0.st http://bioconductor.org v3.14.1 Progenesis QI Software Waters https://www.waters.com/waters/en_US/ Progenesis-QI-Software/nav.htm?cid= 134790655&lset=1&locale=en_ US&changedCountry=Y QuantAnalysis Bruker Daltonik v4.3 (Build 110.102.1532) R https://cran.r-project.org v3.6 RColorBrewer https://cran.r-project.org v1.1-2 StepOne Software v2.3 Thermo Fisher Scientific https://www.thermofisher.com/us/en/home/ technical-resources/software-downloads/ StepOne-and-StepOnePlus-Real-Time-PCRSystem.html SummarizedExperiment http://bioconductor.org v1.14.1 Survival https://cran.r-project.org v2.44-1.1 Survminer https://cran.r-project.org v0.4.5 TCGAbiolinks https://github.com/ BioinformaticsFMRP/ TCGAbiolinks v2.9.5 TScratch 1.0 Gebäck et al., 2009 https://github.com/cselab/TScratch UNIFI 1.8.2 Waters https://www.waters.com/waters/en_US/ UNIFI-Scientific-Information-System/ nav.htm?locale=en_US&cid=134801648 WGCNA https://cran.r-project.org v1.66 Other 0.45 mm pore filter Merck Millipore Catt# SLHA033SS 2-well cell culture inserts ibidi Cat# 80209 6 cm cell culture dish Greiner bio-one Cat# 628160 6-well plates TPP Cat# 92006 10 cm cell culture dish TPP Cat# 93100 24-well plates TPP Cat# 92424 70 mm cell strainers BD Biosciences Cat# 352350 96-well tissue culture test plates TPP Cat# 92696 Amicon Ultra-2 mL 30K Centrifugal Filter Units Merck Millipore Cat# UFC203024 (Continued on next page) ll OPEN ACCESS Cell 182, 1252–1270.e1–e20, September 3, 2020 e7 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Black clear bottom 96-well plates BD Biosciences Cat# 353219 Black, clear bottom poly-D-lysine coated 384-well plates Corning Cat# 3845 Gentle MACS tubes C Miltenyi Biotec, Cat# 130-093-237 Microplate, 96 well, PS, F-bottom (Chimney well) black, non-binding Greiner bio-one Cat# 655900 Mini-PROTEAN Tetra Cell electrophoresis system Bio-Rad Cat# 1658029FC Nitrocellulose membranes Bio-Rad Cat# 1620112 NuPAGE Novex Bis-Tris Mini Gels 4-12% Invitrogen Cat# NP0329 Polyvinylidene difluoride (PVDF) membrane Millipore Cat# IPVH00010 StarFrost Advanced Adhesive slides Engelbrecht Cat# 11270 Scripts used for data processing, analysis and figure generation in this study This paper https://github.com/ahmedasadik/AHR_IL4I1_ manuscript ll OPEN ACCESS Article ..

    Membrane:

    Article Title: IL4I1 Is a Metabolic Immune Checkpoint that Activates the AHR and Promotes Tumor Progression.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER GSVA http://bioconductor.org v1.32.0 Hmisc https://cran.r-project.org v4.2-0 Image Lab software 6.0.1 Bio-Rad https://www.bio-rad.com/de-de/product/ image-lab-software?ID=KRE6P5E8Z JCoRe https://github.com/ JULIELab/jcore-base v2.4 Limma http://bioconductor.org v3.40.6 and v3.42.2 Lumi http://bioconductor.org v2.36.0 MassHunter B06.00 or B10.00 software packages Agilent https://www.agilent.com/en/products/software- informatics/mass-spectrometry-software MassLynx 4.1 Software Waters https://www.waters.com/waters/en_US/MassLynx- MS-Software/nav.htm?cid=513662&locale=en_US MOFA http://bioconductor.org v1.0.0 mogene20sttranscriptcluster.db http://bioconductor.org v8.7.0 NIS Elements software version 4.13.04 Nikon https://www.microscope.healthcare.nikon. com/de_EU/products/software/nis-elements Oligo http://bioconductor.org v1.48.0 org.Hs.eg.db http://bioconductor.org v3.8.2 pd.hugene.2.0.st http://bioconductor.org v3.14.1 Progenesis QI Software Waters https://www.waters.com/waters/en_US/ Progenesis-QI-Software/nav.htm?cid= 134790655&lset=1&locale=en_ US&changedCountry=Y QuantAnalysis Bruker Daltonik v4.3 (Build 110.102.1532) R https://cran.r-project.org v3.6 RColorBrewer https://cran.r-project.org v1.1-2 StepOne Software v2.3 Thermo Fisher Scientific https://www.thermofisher.com/us/en/home/ technical-resources/software-downloads/ StepOne-and-StepOnePlus-Real-Time-PCRSystem.html SummarizedExperiment http://bioconductor.org v1.14.1 Survival https://cran.r-project.org v2.44-1.1 Survminer https://cran.r-project.org v0.4.5 TCGAbiolinks https://github.com/ BioinformaticsFMRP/ TCGAbiolinks v2.9.5 TScratch 1.0 Gebäck et al., 2009 https://github.com/cselab/TScratch UNIFI 1.8.2 Waters https://www.waters.com/waters/en_US/ UNIFI-Scientific-Information-System/ nav.htm?locale=en_US&cid=134801648 WGCNA https://cran.r-project.org v1.66 Other 0.45 mm pore filter Merck Millipore Catt# SLHA033SS 2-well cell culture inserts ibidi Cat# 80209 6 cm cell culture dish Greiner bio-one Cat# 628160 6-well plates TPP Cat# 92006 10 cm cell culture dish TPP Cat# 93100 24-well plates TPP Cat# 92424 70 mm cell strainers BD Biosciences Cat# 352350 96-well tissue culture test plates TPP Cat# 92696 Amicon Ultra-2 mL 30K Centrifugal Filter Units Merck Millipore Cat# UFC203024 (Continued on next page) ll OPEN ACCESS Cell 182, 1252–1270.e1–e20, September 3, 2020 e7 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Black clear bottom 96-well plates BD Biosciences Cat# 353219 Black, clear bottom poly-D-lysine coated 384-well plates Corning Cat# 3845 Gentle MACS tubes C Miltenyi Biotec, Cat# 130-093-237 Microplate, 96 well, PS, F-bottom (Chimney well) black, non-binding Greiner bio-one Cat# 655900 Mini-PROTEAN Tetra Cell electrophoresis system Bio-Rad Cat# 1658029FC Nitrocellulose membranes Bio-Rad Cat# 1620112 NuPAGE Novex Bis-Tris Mini Gels 4-12% Invitrogen Cat# NP0329 Polyvinylidene difluoride (PVDF) membrane Millipore Cat# IPVH00010 StarFrost Advanced Adhesive slides Engelbrecht Cat# 11270 Scripts used for data processing, analysis and figure generation in this study This paper https://github.com/ahmedasadik/AHR_IL4I1_ manuscript ll OPEN ACCESS Article ..

    Adhesive:

    Article Title: IL4I1 Is a Metabolic Immune Checkpoint that Activates the AHR and Promotes Tumor Progression.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER GSVA http://bioconductor.org v1.32.0 Hmisc https://cran.r-project.org v4.2-0 Image Lab software 6.0.1 Bio-Rad https://www.bio-rad.com/de-de/product/ image-lab-software?ID=KRE6P5E8Z JCoRe https://github.com/ JULIELab/jcore-base v2.4 Limma http://bioconductor.org v3.40.6 and v3.42.2 Lumi http://bioconductor.org v2.36.0 MassHunter B06.00 or B10.00 software packages Agilent https://www.agilent.com/en/products/software- informatics/mass-spectrometry-software MassLynx 4.1 Software Waters https://www.waters.com/waters/en_US/MassLynx- MS-Software/nav.htm?cid=513662&locale=en_US MOFA http://bioconductor.org v1.0.0 mogene20sttranscriptcluster.db http://bioconductor.org v8.7.0 NIS Elements software version 4.13.04 Nikon https://www.microscope.healthcare.nikon. com/de_EU/products/software/nis-elements Oligo http://bioconductor.org v1.48.0 org.Hs.eg.db http://bioconductor.org v3.8.2 pd.hugene.2.0.st http://bioconductor.org v3.14.1 Progenesis QI Software Waters https://www.waters.com/waters/en_US/ Progenesis-QI-Software/nav.htm?cid= 134790655&lset=1&locale=en_ US&changedCountry=Y QuantAnalysis Bruker Daltonik v4.3 (Build 110.102.1532) R https://cran.r-project.org v3.6 RColorBrewer https://cran.r-project.org v1.1-2 StepOne Software v2.3 Thermo Fisher Scientific https://www.thermofisher.com/us/en/home/ technical-resources/software-downloads/ StepOne-and-StepOnePlus-Real-Time-PCRSystem.html SummarizedExperiment http://bioconductor.org v1.14.1 Survival https://cran.r-project.org v2.44-1.1 Survminer https://cran.r-project.org v0.4.5 TCGAbiolinks https://github.com/ BioinformaticsFMRP/ TCGAbiolinks v2.9.5 TScratch 1.0 Gebäck et al., 2009 https://github.com/cselab/TScratch UNIFI 1.8.2 Waters https://www.waters.com/waters/en_US/ UNIFI-Scientific-Information-System/ nav.htm?locale=en_US&cid=134801648 WGCNA https://cran.r-project.org v1.66 Other 0.45 mm pore filter Merck Millipore Catt# SLHA033SS 2-well cell culture inserts ibidi Cat# 80209 6 cm cell culture dish Greiner bio-one Cat# 628160 6-well plates TPP Cat# 92006 10 cm cell culture dish TPP Cat# 93100 24-well plates TPP Cat# 92424 70 mm cell strainers BD Biosciences Cat# 352350 96-well tissue culture test plates TPP Cat# 92696 Amicon Ultra-2 mL 30K Centrifugal Filter Units Merck Millipore Cat# UFC203024 (Continued on next page) ll OPEN ACCESS Cell 182, 1252–1270.e1–e20, September 3, 2020 e7 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Black clear bottom 96-well plates BD Biosciences Cat# 353219 Black, clear bottom poly-D-lysine coated 384-well plates Corning Cat# 3845 Gentle MACS tubes C Miltenyi Biotec, Cat# 130-093-237 Microplate, 96 well, PS, F-bottom (Chimney well) black, non-binding Greiner bio-one Cat# 655900 Mini-PROTEAN Tetra Cell electrophoresis system Bio-Rad Cat# 1658029FC Nitrocellulose membranes Bio-Rad Cat# 1620112 NuPAGE Novex Bis-Tris Mini Gels 4-12% Invitrogen Cat# NP0329 Polyvinylidene difluoride (PVDF) membrane Millipore Cat# IPVH00010 StarFrost Advanced Adhesive slides Engelbrecht Cat# 11270 Scripts used for data processing, analysis and figure generation in this study This paper https://github.com/ahmedasadik/AHR_IL4I1_ manuscript ll OPEN ACCESS Article ..

    Sequencing:

    Article Title: Integrin α6β4 Recognition of a Linear Motif of Bullous Pemphigoid Antigen BP230 Controls Its Recruitment to Hemidesmosomes.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ATSAS (Franke et al., 2017) https://www.embl-hamburg.de/ biosaxs/software.html RRID:SCR_015648 AUTORG (Petoukhov et al., 2007) https://www.embl-hamburg.de/ biosaxs/manuals/autorg.html GNOM (Svergun, 1992) https://www.embl-hamburg.de/ biosaxs/gnom.html EOM 2.1 (Tria et al., 2015) https://www.embl-hamburg.de/ biosaxs/eom.html DeerAnalysis (Jeschke et al., 2006) http://www.epr.ethz.ch/software.html DynDom (Hayward and Berendsen, 1998) http://fizz.cmp.uea.ac.uk/dyndom/ Consurf (Ashkenazy et al., 2016) http://consurf.tau.ac.il/2016/ Rosetta Sequence Tolerance (Smith and Kortemme, 2011) http://rosie.rosettacommons.org/ sequence_tolerance/ Pymol Schrodinger LLC http://www.pymol.org RRID:SCR_000305 Phosphonet Kinexus Bioinformatics http://www.phosphonet.ca/ RRID:SCR_013070 ImageJ (Schneider et al., 2012) https://imagej.nih.gov/ij/ RRID:SCR_003070 JACoP plugin for ImageJ (Bolte and Cordelieres, 2006) https://imagej.nih.gov/ij/plugins/ track/jacop2.html GraphPad Prism GraphPad Software https://www.graphpad.com RRID:SCR_002798 SigmaPlot 11 Systat Software Inc. https://systatsoftware.com RRID:SCR_003210 Other HisTrap columns GE Healthcare Cat# 17524802 Glutathione-agarose resin Agarose Bead Technologies Cat# 4B-GLU-10 Superdex 200 10/300 GL GE Healthcare Cat# 17-5175-01 Microplate, black, 384-well, non-binding Greiner Bio-One Cat# 781900 .. REAGENT or RESOURCE SOURCE IDENTIFIER ATSAS (Franke et al., 2017) https://www.embl-hamburg.de/ biosaxs/software.html RRID:SCR_015648 AUTORG (Petoukhov et al., 2007) https://www.embl-hamburg.de/ biosaxs/manuals/autorg.html GNOM (Svergun, 1992) https://www.embl-hamburg.de/ biosaxs/gnom.html EOM 2.1 (Tria et al., 2015) https://www.embl-hamburg.de/ biosaxs/eom.html DeerAnalysis (Jeschke et al., 2006) http://www.epr.ethz.ch/software.html DynDom (Hayward and Berendsen, 1998) http://fizz.cmp.uea.ac.uk/dyndom/ Consurf (Ashkenazy et al., 2016) http://consurf.tau.ac.il/2016/ Rosetta Sequence Tolerance (Smith and Kortemme, 2011) http://rosie.rosettacommons.org/ sequence_tolerance/ Pymol Schrodinger LLC http://www.pymol.org RRID:SCR_000305 Phosphonet Kinexus Bioinformatics http://www.phosphonet.ca/ RRID:SCR_013070 ImageJ (Schneider et al., 2012) https://imagej.nih.gov/ij/ RRID:SCR_003070 JACoP plugin for ImageJ (Bolte and Cordelieres, 2006) https://imagej.nih.gov/ij/plugins/ track/jacop2.html GraphPad Prism GraphPad Software https://www.graphpad.com RRID:SCR_002798 SigmaPlot 11 Systat Software Inc. https://systatsoftware.com RRID:SCR_003210 Other HisTrap columns GE Healthcare Cat# 17524802 Glutathione-agarose resin Agarose Bead Technologies Cat# 4B-GLU-10 Superdex 200 10/300 GL GE Healthcare Cat# 17-5175-01 Microplate, black, 384-well, non-binding Greiner Bio-One Cat# 781900 ..



    Similar Products

    flat bottom black non binding greiner bio one  (Greiner Bio)
    95
    Greiner Bio flat bottom black non binding greiner bio one
    Flat Bottom Black Non Binding Greiner Bio One, supplied by Greiner Bio, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non+binding+greiner+bio+one/Microplate+384+Well+Ps+F-Bottom+Black/pmc12446458__41467_2025_64082_MOESM1_ESM-119-74-78
    Average 95 stars, based on 1 article reviews
    flat bottom black non binding greiner bio one - by Bioz Stars, 2026-09
    95/100 stars
    		  Buy from Supplier
    non-binding 384-well plates greiner-bio-one  (Greiner Bio)
    90
    Greiner Bio non-binding 384-well plates greiner-bio-one
    Non Binding 384 Well Plates Greiner Bio One, supplied by Greiner Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non+binding+greiner+bio+one/96+well+plates/us12304954-1458-9-12
    Average 90 stars, based on 1 article reviews
    non-binding 384-well plates greiner-bio-one - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    384-well black, non-binding microtiter plate greiner bio-one  (Greiner Bio)
    90
    Greiner Bio 384-well black, non-binding microtiter plate greiner bio-one
    384 Well Black, Non Binding Microtiter Plate Greiner Bio One, supplied by Greiner Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non+binding+greiner+bio+one/96+well+plates/pmc12056667-242-15-18
    Average 90 stars, based on 1 article reviews
    384-well black, non-binding microtiter plate greiner bio-one - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    black 384-well, f-bottom, small volume, non-binding microplate greiner bio-one  (Greiner Bio)
    90
    Greiner Bio black 384-well, f-bottom, small volume, non-binding microplate greiner bio-one
    Black 384 Well, F Bottom, Small Volume, Non Binding Microplate Greiner Bio One, supplied by Greiner Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non+binding+greiner+bio+one/96+well+plates/pm39814716-355-13-18
    Average 90 stars, based on 1 article reviews
    black 384-well, f-bottom, small volume, non-binding microplate greiner bio-one - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    384-well, non-binding, black plates greiner bio-one  (Greiner Bio)
    90
    Greiner Bio 384-well, non-binding, black plates greiner bio-one
    384 Well, Non Binding, Black Plates Greiner Bio One, supplied by Greiner Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non+binding+greiner+bio+one/96+well+plates/10__1038_slash_s44320___024___00082___1-293-13-16
    Average 90 stars, based on 1 article reviews
    384-well, non-binding, black plates greiner bio-one - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    non-binding microplates greiner bio-one  (Greiner Bio)
    90
    Greiner Bio non-binding microplates greiner bio-one
    Non Binding Microplates Greiner Bio One, supplied by Greiner Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non+binding+greiner+bio+one/96+well+plates/us12098173-381-12-14
    Average 90 stars, based on 1 article reviews
    non-binding microplates greiner bio-one - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    black, non-binding, 96-well fluorescence microplate greiner bio one  (Greiner Bio)
    90
    Greiner Bio black, non-binding, 96-well fluorescence microplate greiner bio one
    Black, Non Binding, 96 Well Fluorescence Microplate Greiner Bio One, supplied by Greiner Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non+binding+greiner+bio+one/96+well+plates/pm39303295__jm4c01262_si_002-27-8-12
    Average 90 stars, based on 1 article reviews
    black, non-binding, 96-well fluorescence microplate greiner bio one - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    384-well microplates greiner bio-one black, clear bottom, non-binding, low volume  (Greiner Bio)
    90
    Greiner Bio 384-well microplates greiner bio-one black, clear bottom, non-binding, low volume
    384 Well Microplates Greiner Bio One Black, Clear Bottom, Non Binding, Low Volume, supplied by Greiner Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non+binding+greiner+bio+one/96+well+plates/pm37549471-66-5-7
    Average 90 stars, based on 1 article reviews
    384-well microplates greiner bio-one black, clear bottom, non-binding, low volume - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    non binding greiner bio one 96 well microplate  (Greiner Bio)
    96
    Greiner Bio non binding greiner bio one 96 well microplate
    Non Binding Greiner Bio One 96 Well Microplate, supplied by Greiner Bio, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/non+binding+greiner+bio+one/Microplate+96+Well+F-Bottom/pmc10556780__mmc1-22-13-14
    Average 96 stars, based on 1 article reviews
    non binding greiner bio one 96 well microplate - by Bioz Stars, 2026-09
    96/100 stars
    		  Buy from Supplier

    Image Search Results